Human Variation & Race

1. High Levels of solar radiation be detrimental to humans in the following ways. It can cause humans to get skin cancer because of overexposure to the UV rays. To much exposure to solar radiation can cause sunburn when the skin cells are damaged. It can also have a negative effect on our immune system making it harder to fight off illness. It is also known to damage vision if you absorb the solar radiation through your eyes.

 

2.

• There really isn't a short term adaptation to solar radiation the body doesn't react very quickly to this kind of stress. That makes UV radiation very dangerous and something that should be protected against.
• Humans Facilitative adaptation to this stress is our ability to tan. After excessive exposure to UV rays our skin becomes darker as a defense mechanism against the solar radiation. Melanin is produced as we get exposure to the sun. There are two types of melanin, pheomelanin which is red in color and is seen when someone gets a sunburn. The second is eumelanin which is dark brown and seen when you get a tan. Melanin protects the body by absorbing solar radiation.
• An example of developmental radiation is people who have very dark skin that is passed down from generation to generation. This adaptation has changed the DNA of those members of the population because of the long term stress caused by solar radiation. Their skin pigment can not change like a tan, it offers permanent protection from the UV rays damaging effects.
• An example of cultural adaptation is wearing clothes to protect skin from harmful UV rays, but more importantly the development of sunscreen which acts as a shield for the skin and protects against the sun suns damaging effect on skin.

3. The benefits of studying human variation is that we learn how our bodies react to certain environmental stressors. This will lead to us learning the risks associated with different environments. Also we will be able to protect ourselves from these risks. One example is studying how the sun's rays are absorbed into our skin and developing sun screen that stops a certain amount of those rays from damaging skin. Another example is studying diseases such as rickets and learning why a lack of sun can be so detrimental to our health. Eventually this will lead us to cures and treatments for those diseases.

 

4. I would look at race to understand variations of adaptations because most races were geographically isolated at one point in time which means they were subject to similar environmental stressors. This means you can see the long term effects of certain environmental stressors by looking at race. However, it would be better to look at areas with a specific environmental influence rather then race because our society has become very integrated and people not longer live in only one geographic area so just because a person is a member of a particular race does not mean they were subject to the similar environmental conditions. To study all other aspects of how our environmental stressors effect us you should look at people from a specific geographic group that has the environmental stressor you are looking at. It does not matter what race the people are as long as they are exposed to the same stressors.

 

Language Post



 

      This experiment was easy, however sometimes communicating your thoughts in a coherent way was difficult. At first when I was not aloud to speak, write, or use sign language to talk it was difficult to communicate complex ideas. I had to use hand gestures and act things out when I wanted to say something. This led to some pretty funny interpretations of what I was trying to say. I noticed that my partners changed the way they talked to me, instead of saying things that would lead to a conversation they worded things in a way where I could give a simple "yes" or "no" answer by nodding my head, or made it simple enough to where I could just point to convey my thoughts. If me and my partners represented two different cultures, my partners definitely had the advantage in their ability to communicate complex ideas. It is nearly impossible to convey a complex thought without speaking. The speaking culture might have the attitude that the culture that only uses symbolic language is not as intelligent as themselves. Immigrants in our country can have difficulty communicating in English if they are not used to speaking it in the country they are from. This means that people who do speak to them in English must make their sentences simple, and rely on hand gestures to make their thoughts easier to understand. This does not mean the immigrants are stupid. It takes a lot of time to understand the complexities of the English language, and you wouldn't speak the same to a person who is just learning English compared to someone who has spoke it their whole life.

    

      I did not make it the full 15 minutes without using physical embellishments. For the most part I only used speech with no emphasis on my tone of voice. My partners were making fun of me because I was so monotone with what I was saying. It was just the words coming out with no emotion behind them. It was easier to communicate only using speech then only using hang gestures. However, I had to add a lot more words to my sentences then I usually would. Instead of pointing to where something was I had to describe it very well so that I could be understood. This experiment made me realize that non speech language is very important to adding depth to our communication. Everyday we use a mixture of verbal and non verbal communication in our speech. If you take one out of the equation speech becomes difficult and in some cases makes it so you cannot communicate some ideas. There probably are people who have difficulties in picking up on the subtleties of body language. Reading body language is important because people do not always mean what they say. Body language allows you to pick up on sarcasm as well as other things. It also allows you to pick up on sarcasm as well as other things. It also makes a person able to communicate some thoughts when silence is necessary. Such as when soldiers use body language to communicate their strategies when verbal communication could alert the enemy to their presence. I cannot think of a situation where being able to read body language could be detrimental to a person.  

Piltdown Hoax

• In 1912 in a village called Piltdown in England 3 scientists made an "amazing" discovery. Charles Dawson, Arthur Smith Woodland, and Father Pierre found what they claimed to be the skull of an ancient human ancestor from millions of years ago. The fossils were found in a gravel pit in the town of Piltdown. For decades the find had scientists fooled to believe that was an early human ancestor. Until in 1949 when scientists were able to do a fluorine test on the skull and were puzzled when it turned out to look like it was only a few hundred thousand years old. Then in 1953 scientists took a better look at the skull with better dating methods and discovered many shocking things. First, that the skull was dyed a darker color to make it appear aged over millions of years. Second, the bones had been cut with a steel knife after they had already been fossilized in several areas so that you cannot get a complete picture of the skull and must fill in the blanks yourself. Third, the teeth on the jawbone were filed down to make them flat like a humans teeth would look. Lastly, the test proved that the skull was only about a hundred years old and was from the bones of a female chimpanzee. Father Pierre was very quiet when this was discovered, and others in the scientific community felt their credibility hurt and wanted to move past this hoax and continue with good honest science. It is not certain who was behind the hoax, but Charles Dawson is a very good suspect because he made the first discovery and the last one.

• This scenario is a great example of several human faults. Greed could have played a motivational role in this crime, the person(s) behind it wanted fame, attention, and recognition even if it was based on a lie. Then there was jealousy, some other countries had already found ancient human fossils, but England had not. In some peoples eyes this made England inferior in some ways to these other countries this is a possible motive for the hoax. Another is deceit to gain credibility, the findings of the skull showed that ancient humans developed a large skull before they could walk (which is not true) matched the theory of a scientist at the time. It is possible that he set up the findings so that his theory would be accepted as truth. Lastly is spite, one of the people working for Dawson did not like him and could have planted the fossils to ruin his reputation.

• The positive aspects of the scientific process are the advanced dating technology that aloud for the hoax to be discovered. Scientists first used a fluorine test that raised questions about the Piltdown Skull. A few years later in 1953 radiocarbon dating was used to show that the skull was barely 100 years old.  

• It is not possible to remove the "human" factor from science. A big part of science involves new ideas and theories being proven or disproven that help us to better understand the world around us. No machine can form its own ideas or think as critically as a human can so at this time it is not possible to remove the human factor from science. Even if we could I would not want to remove humans from science. machines can never compare to the ambition, intelligence, and hard work of scientists and they should never be replaced. However, humans work should be checked and tested so that it can be proven by everyone, to protect ourselves from another Piltdown hoax.

• Always be skeptical, I would never take something at face value from an unverified source. Even well known sources can use their credibility to lie and manipulate people because they bank on nobody checking the facts because they are a credible source. Do your own thinking, don't let others think for you. If you figure things out by your own research and test the research of others you will not be so easy to fool.

Locomotion

 

 

Lemurs are found on the island of Madagascar. The island has a very harsh climate, it is a very unpredictable place to live. Sometimes there will be long periods of drought and other times there will be excessive flooding due to cyclones. Madagascar is composed of rain forests and dry forests. Due to the climate there is many species of lemurs that have adapted to live successfully in the different parts of the island. Locomotion in lemurs varies a lot because of the diversity of the species. However, the locomotion of these animals can be put into two main groups. There are lemurs who are vertical clingers and those who leap. Depending on their environment lemurs will use one or the other form of locomotion. Lemurs use their strong back legs to vertically jump from tree to tree, when the next tree is to far to jump to then the lemurs climb to the ground and leap sideways on two legs until they get to the next tree and can climb up it.

 

 

Spider Monkeys live in the tropical rain forests of central and South America. They spend most of their time in trees and prefer to thrive in areas with a canopy over them. Scientists have taken note of several locomotion patterns in spider monkeys. The three main types of locomotion they use are quadrupedal, suspensory, and bipedalism. In quadrupedal locomotion they use all four limbs to walk or run. In suspensory locomotion is when they hang, climb, or glide from tree to tree. Bipedalism is when they use two limbs to leap, walk, or run. The type of locomotion they choose is based on their environment. They mostly use suspensory locomotion when they are in an area with a lot of trees close together. When they need to move in an area with less trees however, they must use another form of locomotion.

 

 

Baboons live in Africa or Arabia. They prefer to live in the savannah or other partially-arid climates. This means that baboons spend most of their time living on the ground. The locomotion exhibited by baboons is quadrupedal which means they walk on all fours. The reason they do this is because of their environment. They usually live in open areas and must walk from place to place. Unlike some primates baboons don't swing from tree to tree they use their four legs to walk around because the areas they inhabit have little to no trees.

 

 



 

Gibbons live in rain forests in southern Asia. For the most part they live in trees. The forests they like to live in are dense with a lot of trees. The type of locomotion these animals use is called branchiating which is an extreme form of suspensory locomotion. They also have been seen walking on branches or on the ground on two legs which is called bipedalism, but branchiating is their main form of locomotion. They gracefully swing from tree to tree using this skill. Their specific environment of dense trees is the reason they developed this form of locomotion. Unlike the baboons who walk on all fours because they live in open areas, gibbons swing from tree to tree because they live in dense areas.

 

 

Chimpanzees can inhabit African rain forests, woodlands, and grasslands. They exhibit three forms of locomotion because of their diverse environment. They walk on all fours, which is quadrupedal locomotion. They swing in trees which is suspensory locomotion. As well as being able to walk on two feet which is bipedal locomotion. Their environment enables them to use all of these forms of locomotion because it is diverse.

 

In conclusion, after researching all of these animals I realize that environment plays a key role in what type of locomotion a certain species displays. Animals who live in areas without lots of trees such as baboons use quadrupedal locomotion because they don't need the skill of suspensory locomotion, their environment does not call for it. Animals who live in denser areas such as gibbons lemurs and spider monkeys rely mostly on suspensory locomotion because of their tree filled environment. Animals who live in diverse environments with areas with trees and flat areas such as the chimpanzee rely on multiple forms of locomotion to be able to navigate their environment. So, the environment an animal lives in forces the animal to adapt to a specific form of locomotion. You wouldn't need to swing from tree to tree if you are a baboon who lives on the open planes of the savannah. Also you wouldn't have to spend much time walking on all fours or on two legs if you are a gibbon because your environment makes it necessary to swing from tree to tree. 

Homologous Vs. Analogous

 

The Bones in a human arm are homologous to the bones in the front fins of a whale. The bones in each are basically the same structure, but each serve a very different function.


     A human arm has two larger bones leading down to the wrist and fingers (phalanges). Humans use their arms for countless tasks, from sports and communicating, to eating and working with tools, as well as many other things. A whales arm is similar to a humans in the fact that it has two larger bones leading down to five smaller bones that look similar to human fingers. However, a whale uses its fins for navigating its way through the ocean. With these appendages whales can propel themselves through the water as well as use their fins to turn side to side, or up and down.

     The traits between humans and whales are similar because they share a common ancestor. Both humans and whales are placental mammals, this means that the mothers nourish their babies through the placenta before they are born. Scientists have created an image of what this possible ancient placental mammal might have looked like. You may notice that is possesses a similar arm structure to humans and whales. While this reconstruction is not exactly what this creature may have looked like, scientists know certain traits this creature had to possess to be related to both humans and whales; one of these traits was the structure of the arm bones.

An example of an analogous shared trait is the wings of a butterfly and the wings of a dove. Both of the animals have wings but did not evolve them from a common ancestor.

 

     The wings of both species allow give them the ability to fly. The traits seem so similar because they both do the same job, allowing the creature to fly from place to place eating food and gathering other resources. So even though the wings of both animals are similar it is not due to a common ancestor, it is because of convergent evolution.  

 

 

     Doves and Butterflies both evolved from separate ancestors without wings. I was not able to find a shared common ancestor in my research. However I was able to find out that doves evolved from a reptile without wings, and butterflies evolved from an arthropod without wings. This means that the ancestors of these species did not share this analogous trait. 

 

 

 

 

 

 

 

 

 

 

Protein Synthesis Assignment

ACAATACCAAGGGAACGTCTGAACGCAAGGCAAGTTGATC

Historical Influences on Charles Darwin.

• Thomas Malthus observed that plants and animals produce far more offspring than are able to survive. He also noted that humans can overproduce as well as animals. Malthus originally used this information to explain why some people were in poverty. Malthus thought poverty was the expected outcome from humans overproducing. The writers at University of California Museum of Paleontology explain, "Both Darwin and Wallace independently arrived at similar theories of Natural Selection after reading Malthus...they realized that producing more offspring than can survive establishes a competitive environment among siblings, and that the variation around siblings would produce some individuals with a slightly greater chance of survival." Malthus influenced science (even if he did not know it at the time) by laying the ground work for people like Charles Darwin to build off his ideas and form some theories that are still around today.
• Malthus affects the bullet point about preventing organisms from reaching their full potential. He provided the building blocks for this point because he explained that overproducing can lead to poverty. Some parents are physically capable of having more kids, but they cant afford to take care of them so they don't reach their reproducing potential. This is similar to Darwin's point that a lack of resources can keep animals from producing as many young as they are capable of. Malthus said this, but chose different words and did not go as in depth into the subject as Charles Darwin did. 
• I do not believe that Darwin could have developed his theory of Natural Selection without the influence of Malthus. In an article written by the University of California Museum of Paleontology they state, "This often quoted passage reflects the significance Darwin affords Malthus in formulating his theory of Natural Selection." The quoted passage they are referring to Darwin admits that after reading Malthus's article is when he understood what became his theory of Natural Selection. It would have been hard to come up with that theory without Malthus's article to get Darwin thinking, this is why I do not believe that Darwin could have developed his theory of natural selection without Malthus's influence.
• The church's likely negative reaction to Darwin's book caused him to stall on its publication. Until Darwin received a letter from Wallace, in which Wallace had developed a theory similar to Darwin's and was going to get credit for some of the best work Darwin had been doing. This prompted Darwin to publish his book. After doing so Darwin Received some criticism as expected. Some of the church was angered because Darwin's book did not agree with the literal interpretation of the bible. However, some Christians were open to understanding his theory.

http://www.ucmp.berkeley.edu/history/malthus.html